Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

نویسندگان

  • G E Muscat
  • R Griggs
  • M Downes
  • J Emery
چکیده

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We...

متن کامل

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 1...

متن کامل

Sterol regulatory element-binding protein-1 interacts with the nuclear thyroid hormone receptor to enhance acetyl-CoA carboxylase-alpha transcription in hepatocytes.

In previous work, we characterized a 3,5,3'-triiodothyronine response element (T3RE) in acetyl-CoA carboxylase-alpha (ACCalpha) promoter 2 that mediated 3,5,3'-triiodothyronine (T3) regulation of ACCalpha transcription in chick embryo hepatocytes. Sequence comparison analysis revealed the presence of sterol regulatory element-1 (SRE-1) located 5 bp downstream of the ACCalpha T3RE. Here, we inve...

متن کامل

Thyroid hormone negatively regulates the transcriptional activity of the beta-amyloid precursor protein gene.

The expression of the beta-amyloid precursor protein (APP), which plays a key role in the development of Alzheimer's disease, is regulated by a variety of cellular mediators in a cell-dependent manner. In the present study, we present evidence that thyroid hormones negatively regulate the expression of the APP gene in neuroblastoma cells. Transient transfection studies using plasmids that conta...

متن کامل

Nuclear corepressors mediate the repression of phospholipase A2 group IIa gene transcription by thyroid hormone.

Secretory phospholipase A2 group IIa (PLA2g2a) is associated with inflammation, hyperlipidemia, and atherogenesis. Transcription of the PLA2g2a gene is induced by multiple cytokines. Here, we report the surprising observation that thyroid hormone (T3) inhibited PLA2g2a gene expression in human and rat hepatocytes as well as in rat liver. Moreover, T3 reduced the cytokine-mediated induction of P...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research

دوره 4 4  شماره 

صفحات  -

تاریخ انتشار 1993